Via Research Recognition Day 2024 VCOM-Carolinas

First page Previous page 17 Next page Last page

Biomedical Studies

Linear DNA or its Secondary Structure: Which Will hnRNP E1 Protein Bind to? Olivia Lewis 1 , Daniel Ross, Levi Diggins, OMS-III, Krishna Patel, OMS-II, Rebecca Corallo, OMS-II, Rachel Daley, OMS-II, Sundeep Bhanot, OMS-I, and Bidyut K Mohanty, PhD.* Edward Via College of Osteopathic Medicine, 350 Howard St, Spartanburg, SC 29316

Abstract

References As our current data show, hnRNP E1 binds to both linear and i-motif forms of polycytosine-rich DNA although to varying degrees. Fig. 2 shows hnRNP E1 binding with poly-cytosine rich Cy5-Myc C DNA, so it is expected that this protein binds with the i – motif, rather than the g-quadruplex. Our question was how/where it binds. The CD Spectroscopy results in Fig. 3 show that there is a higher presence of i-motif in Sodium Cacodylate in regard to Myc C DNA, though for Telomere C DNA, there is almost equal formation of i-motif in both pH buffers. This indicates i-motif formation is not only dependent on pH, but the DNA itself. Fig. 4 illustrates again the extent to which hnRNP E1 interacts with Telomere C DNA. This result could suggest that hnRNP E1 bound to the DNA at low pH is stabilizing the i-motif, whereas in high pH, it is reversing the i-motif back into linear DNA. This can also be suggested in Fig. 5 , as TrisKCl shows greater protein-DNA interaction, and the i-motif could be destabilized. Future directions: 1. Cy5-Telemore C DNA pull down with hnRNP E1 and Glutathione Sepharose beads is currently underway. We expect results similar to EMSA. 2. We plan on discovering the interaction between Exochew sequences (shown in Fig. 6 ) and hnRNP E1 at different pH’s using CD Spectroscopy. 3. Another interesting inquiry would be the interaction between hnRNP E1 and a variety of oncogenes at different pH’s. 1. Mohanty BK, Karam JA,Howley BV, Dalton AC, Grelet S,Dincman T, et al. Heterogeneous nuclear ribonucleoprotein E1 binds polycytosine DNA and monitors genome integrity. Life Sci Alliance 2021;4:e202000995.doi:10.26508/lsa.202000995. 2. Patel, K., Lodha, C., Smith, C., Diggins, L., Kolluru V., Ross, D., Syed, C., Lewis, O., Daley, R. and Mohanty, BK. (2023) ExoChew: An exonuclease technique to generate single-stranded DNA libraries. Biorxiv. doi: https://doi.org/10.1101/2023.10.02.560524. October 02, 2023. Acknowledgement content and additional logos can be placed here. NOTE acknowledgement content must include IRB, IACUC and/or IBC approval information [i.e., name of institutional review committee, protocol number AND approval date]. Acknowledgements Figure 6. MME DNA Sequences. Mouse (MME) DNA was sequenced after having gone through the ExoChew process. Double-stranded DNA is converted to single-stranded DNA by an enzymatic process known as the ExoChew Technique. The single-stranded DNA library can be used for many types of work, including protein-DNA interaction. This sequenced DNA shows that the ExoChew process is a successful technique. Highlighted portions are poly-cytosine sequences in which the hnRNP E1 protein can bind to. 1.ACTTCAGATTACGGTACGTATTGCTTCCCCAGATATGGCCCAACCCTCAGCAGTTTCTTAAGACC CATCAGATATTTCCAAACCCAAGGACTGAGAAATGACCCTATGCCTTATTTAGATAGCAATCAGCCT GCTTCTCATA 2.CTCTCTTGCCTCCCTGCAGCTCCCAGCACCCCCCCTAGCACATGGCGCCCCGCCCCGCACG CCCCACCCTGGTCTT 3.CCCCCCGCCGCCCCCCCCCCCCCCCCGCCGCCCCGCCCCGCCGCCGCCCGCCCGCCC GCGGGCGGGGGGGGATCGTGGGCGGCGGTCC 4.GATTCTGCCTGCACCCCACTTCTGCCTGCCACCCACACTCTCCCTCCCCTTCCTGCCCCTTCC ACACACAGA Conclusions and Future Directions

Heterogeneous nuclear ribonucleoprotein E1 (hnRNP E1) is an RNA binding protein, and its knockdown leads to cancer metastasis. hnRNP E1 also binds to polycytosine rich single-stranded DNA sequences present at the promoter-proximal regions of several oncogenes. Polycytosine-rich DNA sequences form noncanonical DNA secondary structures called intercalating motif (i-motif); in contrast, polyguanine-rich sequences, (complementary to i-motif forming polycytosine-rich sequences) can form noncanonical G-quadruplexes. hnRNP E1 has been shown to regulate i-motif-G quadruplex dynamics. However, little is known about how hnRNP E1 interacts with DNA and its secondary structures. What we aim to find in this work is whether hnRNP E1 protein binds to linear polycytosine-rich DNA, its i-motif structure, or both. Knowing that i-motifs are more abundant at low pH and can be regulated by hnRNP E1, we believe that this protein will bind preferentially to i-motifs in lower pH solutions. A large amount of hnRNP E1 protein is needed to carry out in vitro experiments involving various biophysical and biochemical techniques including circular dichroism (CD) spectroscopy, electrophoretic mobility shift assay (EMSA), and protein-DNA pull down assay. We are using these techniques to answer our questions on protein-DNA interactions. For this, we have overexpressed and purified hnRNP E1 protein from E. coli bacteria and commercially obtained fluorescently tagged and untagged oligonucleotides. Introduction or Methods

Figure 2. EMSA Analysis of Cy5 and FAM Tagged Myc C and Myc G DNA interaction with hnRNP E1 protein. A 6% Polyacrylamide gel was used. Myc C DNA is tagged with a fluorescent marker Cy5 (red) and Myc G DNA is tagged with the fluorescent marker, FAM (green). Lanes 2-5 and 7-10 have increasing concentrations of hnRNP E1 protein, and when bound with the DNA, the protein-DNA complex will stay at the top of the gel. The thicker band in lane 5 indicates a higher quantity of formed protein-DNA complexes.

Figure 3. CD Spectroscopy Analysis of Cy5 Tagged Telomere C and Myc C DNA. (A) The DNA used in this analysis is a Cy5 tagged Telomere poly-cytosine rich sequence known to form i-motifs. Four conditions were tested: 15 microliters of Tel C DNA in Sodium Cacodylate (pH 5.5) and Tris KCl (pH 7.4), boiled and non-boiled. Samples were boiled at 100 ° C for 3 minutes and cooled for 15 minutes. The four middle peaks, with similar peak heights, indicate the i-motif formed in Sodium Cacodylate and Tris KCl buffers to the same degree. (B) The DNA used in this analysis is Cy5 tagged Myc C also known to form i-motif. A higher peak indicates a larger amount of i-motif formation.

Figure 4. EMSA Analysis of hnRNP E1 protein interaction with Cy5 Tagged Telomere DNA. The gel used is 6% Polyacrylamide, showing Cy5-Telomere C DNA and its interaction with hnRNP E1 protein in Sodium Cacodylate (pH 5.5)(lanes 1-5) and Tris KCl (pH 7.4)(lanes 6-10). Increasing concentrations of hnRNP E1 were used in lanes 2-5 and 7-10, and the highly fluorescent thick bands at the top of the gel indicate protein-DNA complexes have formed to almost the same degree in both pH buffers.

G-quadruplex

I-motif

Figure 1. Telomere, Myc C, and Myc G Strand Sequences and I-motif and G4 models. (A) The telomere sequence is made up of 2000- 3000 repeats of TTAGGG and AATCCC, from 5’ to 3’ and 3’ to 5’, respectively. At the end of the 5’ to 3’ sequence, there is a single-stranded, G strand overhang 150-300 nucleotides long. (B) The Myc C sequence is 27 nucleotides long with C repeats and the Myc G sequence is 27 nucleotides long with G repeats. (C) The G-quadruplex is a poly-guanine rich sequence formed along single-stranded DNA. (D) The intercalating-motif (i-motif) is a poly-cytosine rich sequence formed along single-stranded DNA.

Cy5-Myc C hnRNP E1

+ +

Sodium Cacodylate

TrisKCl

+ +

Supernatant

Elute

Results

Our results show that hnRNP E1 binds to polycytosine-rich DNA at all pH tested but with varying degrees. Data will be presented, from EMSA as well as from CD spectroscopy and protein-DNA pull down. EMSA and pull-down experiments show variation in hnRNP E1 binding to linear DNA and the i- motif at different pH’s. Contrasting to our hypothesis, interaction with hnRNP E1 and Cy5-Myc C has shown more success at a higher pH, Tris KCl (pH 7.4), rather than Sodium Cacodylate (pH 5.5). On the other hand, Cy5-Telomere C DNA binds almost equally to both pH buffers.

Figure 5. EMSA Analysis of hnRNP E1 protein and Cy5 Tagged Myc C Pull Down with Glutathione Sepharose Beads. The gel used is 6% Polyacrylamide, showing Cy5 Tagged Myc C DNA and its interaction with hnRNP E1 protein in Sodium Cacodylate (pH 5.5)(lanes 2-5) and Tris KCl (pH 7.4)(lanes 6-9). Lanes (from left to right): Cy5-MyC C DNA, Sodium Cacodylate: Supernatant Positive Control, Elute Positive Control, Supernatant Negative Control, Elute Negative Control, Tris KCl: Supernatant Positive Control, Elute Positive Control, Supernatant Negative Control, Elute Negative Control. Fluorescence and fluorescence quality indicates presence of Cy5-Myc C DNA and hnRNP E1, respectively.

2024 Research Recognition Day

Made with FlippingBook - Online Brochure Maker