Via Research Recognition Day 2024 VCOM-Carolinas

First page Previous page 14 Next page Last page

Biomedical Studies

ExoChew: An exonuclease technique to generate single-stranded DNA libraries Krishna Patel, Chirag Lodha, Christopher Smith, Levi Diggins, Venkata Kolluru, Daniel Ross, Christopher Syed, Olivia Lewis, Rachel Daley, Rebecca Corallo, Jacob Thaddeus, Sundeep Bhanot, and Bidyut K Mohanty Edward Via College of Osteopathic Medicine, 350 Howard Street, Spartanburg, SC 29316. Introduction Results Results Introduction

Although DNA in the genome is double-stranded, single-stranded DNA is generated during various processes including DNA replication and repair. Some single-stranded DNAs can form noncanonical structures such as G-quadruplexes and i-motifs, which can regulate gene expression and genome integrity, play important roles in cancer and other genetic disorders, and can therefore be targeted for drug development. Various proteins bind to the single-stranded DNAs site specifically and/or structure-specifically to regulate various DNA transactions. Specifically, single stranded DNA-binding proteins (SSBs) and proteins binding to noncanonical DNA structures can play important roles in genome integrity in all organisms through DNA replication, repair, excision, and recombination. A thorough comprehension of the regulation of such proteins is imperative due to their pivotal roles in maintaining genome stability and influencing tumorigenesis, potentially paving the way for innovative cancer therapies. To explore such sequences and structures genome-wide, it is necessary to generate single-stranded DNA libraries 1 . Current in vitro methods of generating single-stranded DNA libraries involve either heat denaturation of double-stranded DNA libraries or treating DNA with alkali or DMSO followed by neutralization of the reaction mixture. Both methods can result in a significant portion of DNA reannealing to complimentary strands 2,3 . We present ExoChew 1 , a novel, simple, and rapid enzymatic technique to generate single stranded DNA libraries from any genomic DNA. In this method, libraries of double-stranded DNA fragments generated by sonication are treated with either T7 exonuclease or E. coli exonuclease III, which recognize and cleave double- stranded DNA from 5’ ends or 3’ ends respectively, generating single-stranded DNA libraries. Such single-stranded DNA libraries by ExoChew can be used for genome-wide studies on DNA structures and protein-DNA interactions.

Table 1. Analysis of in-house genome-wide DNA sequencing.

E. coli SSB -

B .

Aligned Not Aligned

Aligned Genome Coverage

E. coli exonuclease III -

NMuMG

E. coli 96.52% 3.48% Strep. pyogenes 0.27% 99.73% Mus musculus 0.46% 99.24% Homo sapiens 0.25% 99.75%

T7 exonuclease -

E. coli 96.52% 98.49% Mus musculus 97.51% 97.36%

Sonicated NMuMG gDNA +

1000

1. ExoChew is a simple, rapid enzymatic technique to generate libraries of ssDNA fragments from a library of dsDNA fragments. This technique holds significant potential for commercial applications. 2. The enzymatically generated single-stranded DNA pools can be used for genome-wide studies of protein-DNA interactions and structural studies of DNA, which can lead to advancements in cancer therapies that focus on single-stranded DNA binding proteins and the exploration of unique sequences and structures within the genome. 3. By harnessing the enzymatically generated single-stranded DNA pools, researchers can conduct comprehensive genome-wide studies on protein-DNA interactions and delve into structural analyses of DNA . We have successfully conducted in-house genome-wide sequencing and analysis of the ExoChew products and have identified DNA sequences bound to the protein of our interest. 4. Two potential problems may be encountered in ExoChew technique: o The length of the DNA is reduced by half at the end of the conversion of dsDNA to ssDNA by the exonucleases. We address the issue by conducting ExoChew with two exonucleases in two separate pools of dsDNA (Fig. 1A). Whereas the T7 exonuclease cleaves dsDNA in 5 ’ → 3 ’ direction, the E. coli exonuclease III cleaves dsDNA in 3 ’ → 5 ’ direction. After exonuclease treatment, the two pools are not mixed; they are treated independently in the same manner until the end (Fig. 1B). o Since there are multiple copies of each chromosome and sonication generates fragments of these chromosomes randomly, the dsDNA fragments and, thus, the ssDNA fragments may have some small overlaps that can cause annealing between complementary sequences after one round of ExoChew. This problem is addressed in two ways: ➢ Since the exonuclease is still present and active in the reaction mix, it will cleave the dsDNAs generated by partial annealing between two ssDNAs generating all ssDNA molecules. ➢ When exonuclease is added to dsDNA library for ExoChew reaction, a specific protein that binds to ssDNAs or a ligand or an antibody that binds to a specific DNA structure can be added simultaneously so that the protein-DNA complexes, the ligand-DNA complexes, or the antibody-DNA complexes are formed in real time as the ssDNAs are being generated by ExoChew. Conclusions (A) Sonicated DNA fragments of the E. coli genome were compared with a copy of the reference E. coli genome, revealing substantial alignment of 96.52%. When E. coli fragments were compared with the genomes of other species, however, alignment was minimal. (B) Sonicated DNA fragments of E. coli and mouse match with genome sequences in their respective databases (98.49% and 97.36%, respectively).

100 200 300 400 500

200 300 400 500

100

Figure 2. ExoChew and SSB binding with NMuMG mouse genomic DNA. (A) A 3% agarose gel showing the sonication products of NMuMG DNA. 100% = completion of sonication of the gDNA. (B) A 3% agarose gel showing ExoChew products of sonicated NMuMG gDNA. Lanes: sonicated NMuMG dsDNA (100%), T7 Exo product, and Exo III product. (C) A 6% polyacrylamide gel showing SSB binding to ExoChew products of NMuMG DNA. Lanes (from left to right): sonicated NMuMG gDNA (100%), sonicated NMuMG gDNA + SSB, T7 Exonuclease-treated NMuMG DNA, T7 Exonuclease-treated NMuMG DNA with two different concentrations of SSB, E. coli Exonuclease III-treated NMuMG DNA, and E. coli Exonuclease III-treated NMuMG DNA with two different concentrations of SSB. Whereas dsDNA pools did not show any change in mobility in the absence or presence of SSB, DNA pools treated with T7 Exonuclease and E. coli Exonuclease III, when mixed with SSB moved slowly in comparison to similar pools without SSB treatment.

Methods

E. coli SSB -

MWM

100%

T7 Exonuclease -

Figure 3. ExoChew and SSB binding with A549 human gDNA. A 6% polyacrylamide gel showing binding of E. coli SSB to ExoChew products of A549 DNA. Note that T7 exonuclease treated DNA pool incubated with SSB moved slowly in the polyacrylamide gel in comparison to its untreated equivalent T7 exonuclease product. In contrast, dsDNA pool did not show any change in its mobility in the absence or presence of SSB. bp 1000

Sonicated A549 DNA - 100 bp DNA Ladder +

+ +

1000

100 200 300 400 500

Figure 4. ExoChew followed by purification of ssDNA bound to E1 protein. A. Flowchart.

B .

Figure 1: The ExoChew technique and its uses 1 . (A) An illustration of the Technique:

References

Top: Chromosomal DNA is double-stranded. Middle: Sonication of chromosomal DNA generates a pool of double-stranded fragments (e.g., 350 base pairs). Bottom left: E. coli exonuclease III degrades double stranded DNA fragments in a 3’ → 5’ direction generating single-stranded DNA (ssDNA) fragments. In the process, each strand of a double-stranded DNA (dsDNA) fragment is reduced by half of its original size, thus converting a dsDNA fragment into two non-complementary ssDNA fragments. Bottom right: T7 exonuclease degrades dsDNA fragments in a 5’ → 3’ direction generating ssDNA fragments. In the process, each strand of a dsDNA fragment is reduced by half of its original size, thus converting a dsDNA fragment into two non complementary ssDNA fragments. (B) Usage of the Technique: ssDNA libraries generated by ExoChew technique are currently being used for genome-wide search of specific ssDNA sequences that are recognized by hnRNP E1, a protein that binds to ssDNA. Also, genome wide search of specific ssDNA sequences that form specific structures, such as i-motif and G-quadruplex is under progress. Top left and right: ssDNA libraries generated by ExoChew (T7 and E. coli Exo III) are mixed separately with a specific protein or with an antibody against a DNA structure (e.g., DNA G-quadruplex, i motif, etc). Middle left and right: The DNA-protein or DNA-antibody complexes are pulled down with agarose beads that are attached to the appropriate antibody/ligand, followed by extraction and purification of the DNA. Bottom left and right: The DNA pool pulled down by a protein or an antibody is then sequenced, followed by alignment and comprehensive analysis.

1. Patel, K., Lodha, C., Smith, C., Diggins, L., Kolluru, V., Ross, D., Syed, C., Lewis, O., Daley, R. and Mohanty, BK. (2023) ExoChew: An exonuclease technique to generate single-stranded DNA libraries. Biorxiv. doi: https://doi.org/10.1101/2023.10.02.560524. October 02, 2023. 2. Peña Martinez, C. D., Zeraati, M., Rouet, R., Mazigi, O., Gloss, B., Chan, C. L., ... & Christ, D. (2022). Human genomic DNA is widely interspersed with i-motif structures. bioRxiv, 2022-04. 3. Wang, X., Lim, H. J., & Son, A. (2014). Characterization of denaturation and renaturation of DNA for DNA hybridization. Environmental health and toxicology, 29.

B. Representative sequences identified after ExoChew and GST-E1 pull down. GGACCCAACCCAACCACCCCCCACCACCTGCCTTCTTTCTCTCTCTCCAATAAATAAAAAAAG CCCCCCGCCGCCCCCCCCCCCCCCCCGCCGCCCCGCCCCGCCGCCGCCCGCCCGCCCGCGGGCGGGGGGGGATCGTG GGCGGCGGTCC GTGATTCCCCACCCCCACCCCCCACCCCACCCCCACCCCCCCGCCCCCCCCCCCCCCCATT AGTGATTCACACCCACACCCACCCACCCCCCCACCCACCCACCCCCGTGTGTGTGTGTGTGTGTGTGTGTGAGAGAGAA

I would like to express my sincere appreciation to Dr. Bidyut Mohanty for his invaluable guidance, mentorship, and support throughout the research process. I am also grateful to the rest of the authors for their collaborative efforts and contributions to this work. BKM was supported by VCOM’s REAP grant # 1032453.

2024 Research Recognition Day

Made with FlippingBook - Online Brochure Maker